About   Help   FAQ
Hdgfl1em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Hdgfl1em2(IMPC)Tcp
Name: HDGF like 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316186
Gene: Hdgfl1  Location: Chr13:26952156-26954148 bp, - strand  Genetic Position: Chr13, 12.09 cM, cytoband A3.3
Alliance: Hdgfl1em2(IMPC)Tcp page
IMPC: Hdgfl1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0433 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GTTCGATCCTCGCTGGCCAG and CGCTACCAGGTGTTCTTCTT targeting the 5' side and GCGGTCCAGGGCCTGATTGT and TCTACAAACACCGTGACTAC targeting the 3' side of exon ENSMUSE00000509603 resulting in a 726-bp deletion in Chr13 from 26769238 to 26769963 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 42 and early truncation 4 amino acids later (p.F42Lfs*6). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Hdgfl1 Mutation:  19 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory