Hdgfl1^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hdgfl1^em2(IMPC)Tcp
• Name: HDGF like 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316186
• Gene: Hdgfl1 Location: Chr13:26952156-26954148 bp, - strand Genetic Position: Chr13, 12.09 cM, cytoband A3.3
• Alliance: Hdgfl1^em2(IMPC)Tcp page
• IMPC: Hdgfl1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0433 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GTTCGATCCTCGCTGGCCAG and CGCTACCAGGTGTTCTTCTT targeting the 5' side and GCGGTCCAGGGCCTGATTGT and TCTACAAACACCGTGACTAC targeting the 3' side of exon ENSMUSE00000509603 resulting in a 726-bp deletion in Chr13 from 26769238 to 26769963 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 42 and early truncation 4 amino acids later (p.F42Lfs*6). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Hdgfl1 Mutation: 19 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)