Cyp2d22^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cyp2d22^em2(IMPC)Tcp
• Name: cytochrome P450, family 2, subfamily d, polypeptide 22; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316173
• Gene: Cyp2d22 Location: Chr15:82254728-82264461 bp, - strand Genetic Position: Chr15, 38.57 cM, cytoband E2
• Alliance: Cyp2d22^em2(IMPC)Tcp page
• IMPC: Cyp2d22 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0614 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of ACACTAGCAAGGTCATGATG and GAATGCATTACGGGCAAGCC targeting the 5' side and GGCTTTGGACCACGCTCTCA and CTCTGGGACCTAATTGAGGT targeting the 3' side of exon ENSMUSE00000250238 resulting in a 331-bp deletion of Chr15 from 82374301 to 82374631, and a 1-bp deletion of Chr15 at 82374319 (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cyp2d22 Mutation: 34 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)