About   Help   FAQ
Cyp2d22em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Cyp2d22em2(IMPC)Tcp
Name: cytochrome P450, family 2, subfamily d, polypeptide 22; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316173
Gene: Cyp2d22  Location: Chr15:82254728-82264461 bp, - strand  Genetic Position: Chr15, 38.57 cM, cytoband E2
Alliance: Cyp2d22em2(IMPC)Tcp page
IMPC: Cyp2d22 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0614 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of ACACTAGCAAGGTCATGATG and GAATGCATTACGGGCAAGCC targeting the 5' side and GGCTTTGGACCACGCTCTCA and CTCTGGGACCTAATTGAGGT targeting the 3' side of exon ENSMUSE00000250238 resulting in a 331-bp deletion of Chr15 from 82374301 to 82374631, and a 1-bp deletion of Chr15 at 82374319 (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cyp2d22 Mutation:  36 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory