Cdk12em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Cdk12em2(IMPC)Tcp |
| Name: |
cyclin dependent kinase 12; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316168 |
| Gene: |
Cdk12 Location: Chr11:98093885-98169330 bp, + strand Genetic Position: Chr11, 61.75 cM, cytoband D
|
| Alliance: |
Cdk12em2(IMPC)Tcp page
|
| IMPC: |
Cdk12 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0588 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CAATGGTTATCATAGAATTC and GTAAGAAGCCAATTGTGTAA targeting the 5' side and GCCTTATATTTCAGAGGTTC and TGCACTACACTTTATCAAAA targeting the 3' side of exon ENSMUSE00000577506 resulting in a 823 bp deletion of Chr11 from 98220973 to 98221795 (GRCm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|