About   Help   FAQ
Cdk12em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Cdk12em2(IMPC)Tcp
Name: cyclin dependent kinase 12; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316168
Gene: Cdk12  Location: Chr11:98093885-98169330 bp, + strand  Genetic Position: Chr11, 61.75 cM, cytoband D
Alliance: Cdk12em2(IMPC)Tcp page
IMPC: Cdk12 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0588 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CAATGGTTATCATAGAATTC and GTAAGAAGCCAATTGTGTAA targeting the 5' side and GCCTTATATTTCAGAGGTTC and TGCACTACACTTTATCAAAA targeting the 3' side of exon ENSMUSE00000577506 resulting in a 823 bp deletion of Chr11 from 98220973 to 98221795 (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cdk12 Mutation:  75 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory