Ccdc9b^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc9b^em2(IMPC)Tcp
• Name: coiled-coil domain containing 9B; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316166
• Gene: Ccdc9b Location: Chr2:118584639-118593142 bp, - strand Genetic Position: Chr2, 59.45 cM
• Alliance: Ccdc9b^em2(IMPC)Tcp page
• IMPC: Ccdc9b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele, from project TCPR0366, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences AAGCCGAGTCCACAATGCGC and TGCGCAAGGCAACTATCCTA. This resulted in a 48 bp deletion from Chr2:118761689 to 118761736 (GRCm38), and an insertion of GCTCGGCATCTTTTTCCTC. This mutation is predicted to cause a frameshift with amino acid changes after residue 56 and early truncation 57 amino acids later (p.T57Sfs*59). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ccdc9b Mutation: 25 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)