About   Help   FAQ
Ccdc9bem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc9bem2(IMPC)Tcp
Name: coiled-coil domain containing 9B; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316166
Gene: Ccdc9b  Location: Chr2:118584639-118593142 bp, - strand  Genetic Position: Chr2, 59.45 cM
Alliance: Ccdc9bem2(IMPC)Tcp page
IMPC: Ccdc9b gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele, from project TCPR0366, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences AAGCCGAGTCCACAATGCGC and TGCGCAAGGCAACTATCCTA. This resulted in a 48 bp deletion from Chr2:118761689 to 118761736 (GRCm38), and an insertion of GCTCGGCATCTTTTTCCTC. This mutation is predicted to cause a frameshift with amino acid changes after residue 56 and early truncation 57 amino acids later (p.T57Sfs*59). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ccdc9b Mutation:  25 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/12/2026
MGI 6.24
The Jackson Laboratory