Acad10^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Acad10^em2(IMPC)Tcp
• Name: acyl-Coenzyme A dehydrogenase family, member 10; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316159
• Gene: Acad10 Location: Chr5:121759089-121798577 bp, - strand Genetic Position: Chr5, 61.88 cM, cytoband F
• Alliance: Acad10^em2(IMPC)Tcp page
• IMPC: Acad10 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project TCPR0809 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with 4 single guide RNAs having spacer sequences of CCCGCCATTCCCACAGTATG and TCCTATAACGGGAAGCGTTC targeting the 5' side and ACCCACTCCACCGGTAGGGA and GTGCTCTTACGGATCTGTAA targeting the 3' side of exon ENSMUSE00001224898 and ENSMUSE00001296632 resulting in a 1,529-bp deletion Chr5:121646600 to 121648128 (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Acad10 Mutation: 54 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)