About   Help   FAQ
Flncem1(IMPC)Bay
Endonuclease-mediated Allele Detail
Summary
Symbol: Flncem1(IMPC)Bay
Name: filamin C, gamma; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID: MGI:6257599
Gene: Flnc  Location: Chr6:29433255-29461882 bp, + strand  Genetic Position: Chr6, 12.36 cM
Alliance: Flncem1(IMPC)Bay page
IMPC: Flnc gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 4 guide sequences CCCAGCATTGCTCTGAGCAGACC, GCCATGCCCCACTAGTGCCTGGG, TAGTGTCCACTGACCCCTAAAGG, GAGTTCACCATATGTGACATTGG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Flnc Mutation:  78 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Copyright, and Privacy Statement
Send questions and comments to User Support.
last database update
11/26/2022
MGI 6.22
The Jackson Laboratory