Cdh23^em3(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdh23^em3(IMPC)H
• Name: cadherin related 23 (otocadherin); endonuclease-mediated mutation 3, Harwell
• MGI ID: MGI:6257460
• Gene: Cdh23 Location: Chr10:60138527-60532269 bp, - strand Genetic Position: Chr10, 30.11 cM
• Alliance: Cdh23^em3(IMPC)H page
• IMPC: Cdh23 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated
• Mutation: Single point mutation
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting D10A RNA, 2 guide sequences CCTACAGTACTAACATCTACGAG, CCACGCAGGACAGGCATTTGTCT, and a donor oligo, which resulted in a point mutation allele. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cdh23 Mutation: 275 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)