Pck2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pck2^em1(IMPC)Tcp
• Name: phosphoenolpyruvate carboxykinase 2 (mitochondrial); endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257433
• Gene: Pck2 Location: Chr14:55777721-55787477 bp, + strand Genetic Position: Chr14, 28.19 cM, cytoband C1
• Alliance: Pck2^em1(IMPC)Tcp page
• IMPC: Pck2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1205 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTACCCGTGCCACATCCTTG and GGCACTGTGTCCCGCTGCGA targeting the 5' side and CCATTCAGCATGGGTCCCGT and ATGCGTATTATGACCCGCCT targeting the 3' side of a critical exon. This resulted in a 24-bp indel Chr14: 55543596 to 55543619 and 252-bp del Chr14: 55543654 to 55543905, p.(A122_V129del, S142Hfs*21 resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pck2 Mutation: 29 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)