Rab39b^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab39b^em2(IMPC)Tcp
• Name: RAB39B, member RAS oncogene family; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6157269
• Gene: Rab39b Location: ChrX:74615652-74621837 bp, - strand Genetic Position: ChrX, 38.26 cM
• Alliance: Rab39b^em2(IMPC)Tcp page
• IMPC: Rab39b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences ACGCATCAAGCTCCAGATCT, CACCGAGGGCCGCTTTGCTC, and TGTCATCGGCGATTCCACGG that targeted exon(s) ENSMUSE00001867538.1 ENSMUSE00001867540.1 ENSMUSE00002182154.1. This resulted in deletion(s) of 136 bp (location: ChrX:74621428-74621563; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rab39b Mutation: 9 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)