Rab39bem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rab39bem2(IMPC)Tcp |
| Name: |
RAB39B, member RAS oncogene family; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6157269 |
| Gene: |
Rab39b Location: ChrX:74615652-74621837 bp, - strand Genetic Position: ChrX, 38.26 cM
|
| Alliance: |
Rab39bem2(IMPC)Tcp page
|
| IMPC: |
Rab39b gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0643 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences of TGTCATCGGCGATTCCACGG, CACCGAGGGCCGCTTTGCTC, and ACGCATCAAGCTCCAGATCT targeting exon ENSMUSE00000385171 resulting in a 136-bp deletion of ChrX from 75577822 to 75577957 (gRNA_U to gRNA_D). This mutation is predicted to cause a frameshift with the amino acid changes after residue 18 and early truncation 19 amino acids later (p.T18Gfs*21).
(J:237616)
|
|
|
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
1 reference(s) |
|