Top2aem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Top2aem2(IMPC)Tcp |
| Name: |
topoisomerase (DNA) II alpha; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6157267 |
| Gene: |
Top2a Location: Chr11:98883769-98915015 bp, - strand Genetic Position: Chr11, 62.91 cM
|
| Alliance: |
Top2aem2(IMPC)Tcp page
|
| IMPC: |
Top2a gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences ATGCCTGTGCCTGATCTGAC, GCCCTGCATAAGAACATGGG, GTCAGCATGTATTTTGGGTC, and TTTGAGTTAGAGTGCAGTAT that targeted exon(s) ENSMUSE00000648117.2 ENSMUSE00000648118.2 ENSMUSE00000648119.2 ENSMUSE00000648120.2 ENSMUSE00000648121.2. This resulted in deletion(s) of 9 bp (location: Chr11:98904843-98904851; GRCm39), 302 bp (location: Chr11:98904885-98905186; GRCm39), and 2593 bp (location: Chr11:98905191-98907783; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
4 reference(s) |
|