Dnah9em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dnah9em1(IMPC)Tcp |
| Name: |
dynein, axonemal, heavy chain 9; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
| MGI ID: |
MGI:6156456 |
| Gene: |
Dnah9 Location: Chr11:65722150-66059379 bp, - strand Genetic Position: Chr11, 40.53 cM
|
| Alliance: |
Dnah9em1(IMPC)Tcp page
|
| IMPC: |
Dnah9 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR1050 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCTGGTCACAGCAGTGTCGC and ATGTCTGAGTTCGGTTCTTG targeting the 5' side and AAGCAGGTGAGGACCCGTAA and GGTGGCAGGAATAGCAAATC targeting the 3' side of a critical exon. This resulted in a 272-bp deletion of Chr11 from 66155405 to 66155676 (GRCm38).
(J:237616)
|
|
|
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
2 reference(s) |
|