Dnah9^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnah9^em1(IMPC)Tcp
• Name: dynein, axonemal, heavy chain 9; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156456
• Gene: Dnah9 Location: Chr11:65722150-66059379 bp, - strand Genetic Position: Chr11, 40.53 cM
• Alliance: Dnah9^em1(IMPC)Tcp page
• IMPC: Dnah9 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1050 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCTGGTCACAGCAGTGTCGC and ATGTCTGAGTTCGGTTCTTG targeting the 5' side and AAGCAGGTGAGGACCCGTAA and GGTGGCAGGAATAGCAAATC targeting the 3' side of a critical exon. This resulted in a 272-bp deletion of Chr11 from 66155405 to 66155676 (GRCm38). (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dnah9 Mutation: 233 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)