About   Help   FAQ
Dnah9em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Dnah9em1(IMPC)Tcp
Name: dynein, axonemal, heavy chain 9; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156456
Gene: Dnah9  Location: Chr11:65722150-66059379 bp, - strand  Genetic Position: Chr11, 40.53 cM
Alliance: Dnah9em1(IMPC)Tcp page
IMPC: Dnah9 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1050 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCTGGTCACAGCAGTGTCGC and ATGTCTGAGTTCGGTTCTTG targeting the 5' side and AAGCAGGTGAGGACCCGTAA and GGTGGCAGGAATAGCAAATC targeting the 3' side of a critical exon. This resulted in a 272-bp deletion of Chr11 from 66155405 to 66155676 (GRCm38). (J:237616)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dnah9 Mutation:  234 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory