About   Help   FAQ
Ndrg3em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Ndrg3em1(IMPC)Mbp
Name: N-myc downstream regulated gene 3; endonuclease mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6152522
Gene: Ndrg3  Location: Chr2:156927345-156992056 bp, - strand  Genetic Position: Chr2, 77.89 cM
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davis by injecting CAS9 Protein and 2 guide sequences TCCTGAAATGGGAGTAACCCTGG, CAGGCATCAAGTACACACATCGG, which resulted in a Exon Deletion. (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 6 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ndrg3 Mutation:  39 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
04/06/2021
MGI 6.16
The Jackson Laboratory