Rpainem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Rpainem1(IMPC)J |
Name: |
RPA interacting protein; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5911998 |
Gene: |
Rpain Location: Chr11:70861039-70868659 bp, + strand Genetic Position: Chr11, 43.21 cM, cytoband B4
|
Alliance: |
Rpainem1(IMPC)J page
|
IMPC: |
Rpain gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTACTGGATAAAATTGGCC, CATTTGTTGTTAGTTCAGCT, GCAAAGGCCAGCATTAGGGT and GGTAGGGAAGACTCTGCCCT, which resulted in a 215 bp deletion beginning at Chromosome 11 positive strand position 70,972,871 bp and ending after 70,973,085 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001257298 (exon 3) and 154 bp of flanking intronic sequence including the splice acceptor and donor. In addition there are a couple of indels including an 11 bp insertion (CTGCTCAGAGA) at the deletion site, and a 4 bp insertion (TCAG) and 15 bp deletion (CTAATGCTGGCCTTT) 31 bp after the exon deletion. These indels will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 84 and early truncation 4 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|