Ctsj^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ctsj^em1(IMPC)J
• Name: cathepsin J; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5911511
• Gene: Ctsj Location: Chr13:61147993-61153739 bp, - strand Genetic Position: Chr13, 32.62 cM
• Alliance: Ctsj^em1(IMPC)J page
• IMPC: Ctsj gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTAAAGCATCCACCAAATTG, GGGTCATATCAGTTAAAGAT, ATTCATACTCCTCAGAAGGC and GGACTGTTGTAAGTCATTAC, which resulted in a 420 bp deletion beginning at Chromosome 13 negative strand position 61,002,673 bp and ending after 61,002,254 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000117869 (exon 6) and 257 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 206 and early truncation 12 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ctsj Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)