Ctsjem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ctsjem1(IMPC)J |
Name: |
cathepsin J; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5911511 |
Gene: |
Ctsj Location: Chr13:61147993-61153739 bp, - strand Genetic Position: Chr13, 32.62 cM
|
Alliance: |
Ctsjem1(IMPC)J page
|
IMPC: |
Ctsj gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTAAAGCATCCACCAAATTG, GGGTCATATCAGTTAAAGAT, ATTCATACTCCTCAGAAGGC and GGACTGTTGTAAGTCATTAC, which resulted in a 420 bp deletion beginning at Chromosome 13 negative strand position 61,002,673 bp and ending after 61,002,254 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000117869 (exon 6) and 257 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 206 and early truncation 12 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|