Yeats2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Yeats2em1(IMPC)J |
Name: |
YEATS domain containing 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5910402 |
Gene: |
Yeats2 Location: Chr16:19959813-20051323 bp, + strand Genetic Position: Chr16, 12.37 cM
|
Alliance: |
Yeats2em1(IMPC)J page
|
IMPC: |
Yeats2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GCTGCTGATTTTAAATCAGT, CTGCATGAAACTGTAAGATA and GAGAACACTAAATTTATGGG, which resulted in a 176 bp deletion beginning at Chromosome 16 positive strand position 20,152,865 bp, and ending after 20,153,040 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001279853 (exon 3) and 78 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp intronic deletion 48 bp after the 176 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 34 and early truncation 2 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|