Yeats2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Yeats2^em1(IMPC)J
• Name: YEATS domain containing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5910402
• Gene: Yeats2 Location: Chr16:19959813-20051323 bp, + strand Genetic Position: Chr16, 12.37 cM
• Alliance: Yeats2^em1(IMPC)J page
• IMPC: Yeats2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GCTGCTGATTTTAAATCAGT, CTGCATGAAACTGTAAGATA and GAGAACACTAAATTTATGGG, which resulted in a 176 bp deletion beginning at Chromosome 16 positive strand position 20,152,865 bp, and ending after 20,153,040 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001279853 (exon 3) and 78 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp intronic deletion 48 bp after the 176 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 34 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Yeats2 Mutation: 86 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)