About   Help   FAQ
Cracdem1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Cracdem1(IMPC)J
Name: capping protein inhibiting regulator of actin; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5910368
Gene: Cracd  Location: Chr5:76804359-77021401 bp, + strand  Genetic Position: Chr5, 41.34 cM, cytoband E1
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Hypomorph)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGGCGCTCTTAACATCCAGA, CATGTTGGTTAGGGAGGTGT, GGAACACCTCAGTTAGGAAC and CCCTTCAGTCTGGGTAGTAG, which resulted in a 3153 bp deletion beginning at Chromosome 5 positive strand position 76,856,248 bp and ending after 76,859,400 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000719827 (exon 6) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 179 and early truncation 15 amino acids later. In situ hybridization and qPCR confirmed reduced mRNA levels, indicating a hypomorphic allele. (J:188991, J:278327)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 7 assay results
In Structures Affected by this Mutation: 1 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cracd Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/03/2022
MGI 6.19
The Jackson Laboratory