About   Help   FAQ
Exoc2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Exoc2em1(IMPC)J
Name: exocyst complex component 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5909206
Synonyms: Exoc2-
Gene: Exoc2  Location: Chr13:30968416-31158076 bp, - strand  Genetic Position: Chr13, Syntenic
Alliance: Exoc2em1(IMPC)J page
IMPC: Exoc2 gene page
Exoc2em1(IMPC)J/Exoc2em1(IMPC)J mice exhibit embryonic lethality after E3.5 but before E7.5. Blastocysts grown in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GGTAAAATTAAAGAACCAAA, ATATTTAGGGATATCCCACAand GTATTTGTTATAAGGCCAGC, which resulted in a 346 bp deletion beginning at Chromosome 13 negative strand position 30,935,755 bp ATTTGTTATAAGGCCAGCAG, and ending after CATATTTAGGGATATCCCAC at 30,935,410 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000117295 (exon 4) and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 98 and early truncation 8 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Exoc2 Mutation:  62 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory