Polr1d^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Polr1d^em1(IMPC)J
• Name: polymerase (RNA) I polypeptide D; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5904258
• Gene: Polr1d Location: Chr5:147013860-147048407 bp, + strand Genetic Position: Chr5, 86.73 cM
• Alliance: Polr1d^em1(IMPC)J page
• IMPC: Polr1d gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Polr1d-8546J-1608M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATTTGACTCCAGCAAAGAGG, GCCCTGCTGCAAGATGAAAA, AGATAATTGGGCCAAGGTAG and TAGTGTTGGTTCAATTAAGA, which resulted in a 938 bp deletion beginning at Chromosome 5 positive strand position 147,078,255 bp, CATCTTGCAGCAGGGCCTAC, and ending after AACAGATAATTGGGCCAAGG at 147,079,192 bp (GRCm38/mm10). This mutation deletes exon 2 and 386 bp of flanking intronic sequence including the splice acceptor and polyA site and is predicted to generate the first 8 amino acids followed by nonsense mediated decay. (J:188991)
• Inheritance: Not Specified

Expression

In Mice Carrying this Mutation:	6 assay results
In Structures Affected by this Mutation:	1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Polr1d Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)