Prpf40a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prpf40a^em1(IMPC)J
• Name: pre-mRNA processing factor 40A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5818299
• Synonyms: Prpf40a^em1J
• Gene: Prpf40a Location: Chr2:53024714-53081450 bp, - strand Genetic Position: Chr2, 30.69 cM, cytoband C1
• Alliance: Prpf40a^em1(IMPC)J page
• IMPC: Prpf40a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Prpf40a-8143J-F5722 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATGCGGTCATATTACCACA, AACGTATGGTGGACTTCATT, TTGAAATACATAGCAAGCCT and AGTTTCATGTGTAATCTGTA, which resulted in a 273 bp deletion beginning at Chromosome 2 negative strand position 53,176,555 bp, CTAGGAGTTGAAACCTCTAGA, and ending after AGAGATTGTTCAACAGAAGC at 53,176,283 bp (GRCm38/mm10). This mutation deletes exon 4 and 242 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 126 and early truncation 102 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Prpf40a Mutation: 62 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)