About   Help   FAQ
Muc3aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Muc3aem1(IMPC)J
Name: mucin 3A, cell surface associated; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5776697
Synonyms: Muc3aem1J
Gene: Muc3a  Location: Chr5:137243270-137246852 bp, - strand  Genetic Position: Chr5, Syntenic
Alliance: Muc3aem1(IMPC)J page
IMPC: Muc3a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Muc3a-7685J-F6801 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCCCCCTTCACCTTTGTG, CGGGTCCACTGACTGCCCCA, CAGAGCCTAGCTTTAGTGAA and TGCGAGGGCGGGCTTTTCCA, which resulted in a 398 bp deletion in exon 3 beginning at Chromosome 5 negative strand position 137,211,645 bp, CGACCTTGGAAAAGCCCGCC, and ending after AGGGTGGAGACGACTGCAAT at 137,211,248 bp (GRCm38/mm10). In addition there is a 2 bp intron insertion tc after the deletion which will not effect the mutation. This mutation deletes exon 3 and 235 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 40 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Muc3a Mutation:  8 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory