Ier2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ier2em1(IMPC)J |
Name: |
immediate early response 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5766772 |
Synonyms: |
Ier2em1J |
Gene: |
Ier2 Location: Chr8:85387960-85389481 bp, - strand Genetic Position: Chr8, 41.02 cM
|
Alliance: |
Ier2em1(IMPC)J page
|
IMPC: |
Ier2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele from project Ier2-7674J-M6979 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCAGCAGCGATTTGAGCGA, TGAGCATATTGTCGGCCGGG, ACTGCAACTTCGGCTTCCCG and TACCACTCTCGCATGCAGCG, which resulted in a 404 bp deletion and single base (A) insertion in exon 1 beginning at Chromosome 8 negative strand position 84,662,529 bp, GAAGCCGAAGTTGCAGTGGA, and ending after GCCTGCCGCCCGGCCGACAA at 84,662,126 bp (GRCm38/mm10). This mutation results in a change in amino acid sequence after residue 24 and early truncation 42 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|