About   Help   FAQ
Rmrpem1Litt
Endonuclease-mediated Allele Detail
Summary
Symbol: Rmrpem1Litt
Name: RNA component of mitochondrial RNAase P; endonuclease-mediated mutation 1, Dan R Littman
MGI ID: MGI:5755455
Synonyms: RmrpG270T
Gene: Rmrp  Location: Chr4:43492785-43493059 bp, - strand  Genetic Position: Chr4, 23.04 cM
Alliance: Rmrpem1Litt page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsThis allele was generated by injecting Cas9 RNA and guide RNA (sgRNA_Rmrp_Locus: CACGGGGCTCATTCTCAGCG), resulting in a single nucleotide change (270G>T) corresponding to an allele identified in cartilage-hair hypoplasia (CHH) patients (262G>T). Expression levels of mutant Rmrp RNA in T cells are similar to those found in wildtype animals. (J:228279)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rmrp Mutation:  6 strains or lines available
References
Original:  J:228279 Huang W, et al., DDX5 and its associated lncRNA Rmrp modulate TH17 cell effector functions. Nature. 2015 Dec 24;528(7583):517-22
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory