Ap2s1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ap2s1^em1(IMPC)Tcp
• Name: adaptor-related protein complex 2, sigma 1 subunit; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754583
• Synonyms: Ap2s1^-
• Gene: Ap2s1 Location: Chr7:16472369-16483215 bp, + strand Genetic Position: Chr7, 9.15 cM
• Alliance: Ap2s1^em1(IMPC)Tcp page
• IMPC: Ap2s1 gene page

Ap2s1^em1(IMPC)Tcp/Ap2s1^em1(IMPC)Tcp embryos are arrested prior to gastrulation with embryos recovered at E7.5 but not at E9.5. Embryos at E7.5 are smaller, without the presence of head folds, primitive node or primitive streak formation.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences GATCGAGGAGGTGCACGCCG and GCAAGACGCGCCTGGCCAAG that targeted exon(s) ENSMUSE00000336284.6. This resulted in deletion(s) of 58 bp (location: Chr7:16477192-16477249; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ap2s1 Mutation: 16 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 5 reference(s)