About   Help   FAQ
Ccdc9bem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc9bem1(IMPC)Tcp
Name: coiled-coil domain containing 9B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5754574
Gene: Ccdc9b  Location: Chr2:118584639-118593142 bp, - strand  Genetic Position: Chr2, 59.45 cM
Alliance: Ccdc9bem1(IMPC)Tcp page
IMPC: Ccdc9b gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele produced from project TCPR0366 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences AAGCCGAGTCCACAATGCGC and TGCGCAAGGCAACTATCCTA. This resulted in a 38-bp deletion of Chr2 from 118761694 to 118761731 (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccdc9b Mutation:  25 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory