Scamp2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Scamp2em1(IMPC)J |
Name: |
secretory carrier membrane protein 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5752771 |
Synonyms: |
Scamp2em1J |
Gene: |
Scamp2 Location: Chr9:57468226-57496078 bp, + strand Genetic Position: Chr9, 31.05 cM
|
Alliance: |
Scamp2em1(IMPC)J page
|
IMPC: |
Scamp2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Scamp2-7483J-M6175 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGAGCATTAAGGAATACCAT, CCAGCACAGGCACTTCACCC, ACTCTGAACCACCTTCATGG, and CCTGCTCTACCTGGCACAAG, which resulted in a 349 bp deletion spanning ENSMUSE00000259135 (exon 4) beginning at Chromosome 9 positive strand position 57,579,268 bp, GGCACTCCCATGGTATTCCTT and ending after TACTCTGAACCACCTTCATG at 57,579,616 bp (GRCm38/mm10). This mutation deletes exon 4 and 231 bp of intronic sequence including the splice acceptor and donor. This mutation is expected to cause a change in amino acid sequence after residue 75 and early truncation 14 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|