Pcdhg^em2Rwb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pcdhg^em2Rwb
• Name: protocadherin gamma cluster; endonuclease-mediated mutation 2, Robert W Burgess
• MGI ID: MGI:5644501
• Synonyms: deltaC15
• Gene: Pcdhg Location: unknown Genetic Position: Chr18, Syntenic

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified isoform(s))
• Mutation: Single point mutation
• Mutation details: Using CRISPR/Cas9 mediated mutation, a guide RNA (TAATACGACTCACTATAGAAGGCTCCAGCAGGTGGTAAGTTTAAGAGCTATGCTGGAAAC) was designed to create an early STOP codon (GGT to TAA) near the C-terminus of third protocadherin gamma cluster (Pcdhg) constant exon, resulting in a 15-amino acid C-terminal deletion in the constant domain of all 22 gamma-Pcdh protein isoforms. (J:101977)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pcdhg Mutation: 13 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)