Med20em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Med20em1(IMPC)J |
Name: |
mediator complex subunit 20; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5643678 |
Synonyms: |
Med20em1J |
Gene: |
Med20 Location: Chr17:47922510-47935176 bp, + strand Genetic Position: Chr17, 23.66 cM
|
Alliance: |
Med20em1(IMPC)J page
|
IMPC: |
Med20 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Med20-6705J-M5886 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, AGGAACTCTTGGGGACTGAT and GCTTAGAGTATTTACGTTAA (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 348bp deletion beginning in intron 1 at GGGGACTGATGGGTGGGGAT at Chromosome 17 positive strand position 47,612,827 bp (GRCm38) and ending after GCTTAGAGTATTTACGTTAAT at position 47,613,174 bp in intron 2. This mutation deletes exon 2 and is predicted to cause amino acid sequence changes after residue 4 and early truncation 11 amino acids later. PCR failed to detect the insertion of any loxP sites.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
5 reference(s) |
|