About   Help   FAQ
Smg9em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Smg9em1(IMPC)J
Name: SMG9 nonsense mediated mRNA decay factor; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5616624
Synonyms: Smg9em1J
Gene: Smg9  Location: Chr7:24099106-24122197 bp, + strand  Genetic Position: Chr7, 10.54 cM
Alliance: Smg9em1(IMPC)J page
IMPC: Smg9 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Hypomorph)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project Smg9-6001-MP6R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TCTACGGGATAGAGCGGCGG, which resulted in a 2 bp deletion GG and a 10 bp insertion CTGGGTTCTA in exon 2 beginning at Chromosome 7 positive strand approximate position 24,403,446 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 15 and early truncation 88 amino acids later. QRT-PCR confirmed a severe reduction in transcript expression. (J:188991, J:231968)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 7 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Smg9 Mutation:  40 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/16/2024
MGI 6.23
The Jackson Laboratory