About   Help   FAQ
Adarem1Dmsc
Endonuclease-mediated Allele Detail
Summary
Symbol: Adarem1Dmsc
Name: adenosine deaminase, RNA-specific; endonuclease-mediated mutation 1, Daniella M Schwartz
MGI ID: MGI:8346375
Synonyms: AdarG1007
Gene: Adar  Location: Chr3:89622329-89660753 bp, + strand  Genetic Position: Chr3, 39.19 cM, cytoband F2
Alliance: Adarem1Dmsc page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation details

Glycine codon 956 (GGG) was changed to arginine (AGG) (ENSMUSP00000103028:p.G956R) using an sgRNA (targeting GCAAGGCAAGCTTCGCACCA) and an ssODN template with CRISPR/Cas9 technology. This mutation is equivalent to the human p.G1007R mutation associated with Aicardi-Goutieres syndrome. The G to A alteration is at the splicing donor site of exon 11 and alters the RNA splicing such that five differentially spliced transcripts are identified in homozygotes. However, Western blot analysis only detects the full-length p150 isoform protein at reduced levels. (J:379589)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Adar Mutation:  83 strains or lines available
References
Original:  J:379589 Guo X, et al., Heterozygous ADAR mutant mice exhibit RNA sensing-dependent neuroinflammation and phenotypes associated with Aicardi-Goutieres syndrome. iScience. 2026 Feb 20;29(2):114758
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory