Adarem1Dmsc
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Adarem1Dmsc |
| Name: |
adenosine deaminase, RNA-specific; endonuclease-mediated mutation 1, Daniella M Schwartz |
| MGI ID: |
MGI:8346375 |
| Synonyms: |
AdarG1007 |
| Gene: |
Adar Location: Chr3:89622329-89660753 bp, + strand Genetic Position: Chr3, 39.19 cM, cytoband F2
|
| Alliance: |
Adarem1Dmsc page
|
|
| Strain of Origin: |
Not Applicable
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details:
Glycine codon 956 (GGG) was changed to arginine (AGG) (ENSMUSP00000103028:p.G956R) using an sgRNA (targeting GCAAGGCAAGCTTCGCACCA) and an ssODN template with CRISPR/Cas9 technology. This mutation is equivalent to the human p.G1007R mutation associated with Aicardi-Goutieres syndrome. The G to A alteration is at the splicing donor site of exon 11 and alters the RNA splicing such that five differentially spliced transcripts are identified in homozygotes. However, Western blot analysis only detects the full-length p150 isoform protein at reduced levels.
(J:379589)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Adar Mutation: |
83 strains or lines available
|
|
| Original: |
J:379589 Guo X, et al., Heterozygous ADAR mutant mice exhibit RNA sensing-dependent neuroinflammation and phenotypes associated with Aicardi-Goutieres syndrome. iScience. 2026 Feb 20;29(2):114758 |
| All: |
1 reference(s) |
|