About   Help   FAQ
Mogem2(icre/ERT2)Lusu
Endonuclease-mediated Allele Detail
Summary
Symbol: Mogem2(icre/ERT2)Lusu
Name: myelin oligodendrocyte glycoprotein; endonuclease-mediated mutation 2, Lu Sun
MGI ID: MGI:8242765
Gene: Mog  Location: Chr17:37321635-37334290 bp, - strand  Genetic Position: Chr17, 19.16 cM, cytoband C
Alliance: Mogem2(icre/ERT2)Lusu page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Inducible, Recombinase)
Inducer:    tamoxifen
Mutation:    Insertion
 
Mogem2(icre/ERT2)Lusu expression driven by 1 gene
 
Mutation detailsUsing CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (GGAAUCUGUCCACAGCAAAG) was used to introduce an internal ribosome entry site (IRES) followed by an icre/ERT2 fusion gene (codon improved Cre recombinase fused to a human estrogen receptor ligand binding domain) into the 3' UTR, immediately after the endogenous stop codon of the myelin oligodendrocyte glycoprotein (Mog) gene. (J:101977, J:371751)
Recombinase
activity
Activity:
 Tissue activity of this recombinase allele
Driver: Mog (mouse)
Summary of all recombinase alleles driven by Mog.
 

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mog Mutation:  57 strains or lines available
References
Original:  J:371751 Zhang Y, et al., Neurons sequester the cholesterol-inhibiting TFEB in oligodendrocyte cytoplasm to safeguard myelination and neural function. Cell Rep. 2025 Sep 5;44(9):116252
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory