Mogem2(icre/ERT2)Lusu
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mogem2(icre/ERT2)Lusu |
| Name: |
myelin oligodendrocyte glycoprotein; endonuclease-mediated mutation 2, Lu Sun |
| MGI ID: |
MGI:8242765 |
| Gene: |
Mog Location: Chr17:37321635-37334290 bp, - strand Genetic Position: Chr17, 19.16 cM, cytoband C
|
| Alliance: |
Mogem2(icre/ERT2)Lusu page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Inducible, Recombinase) |
| Inducer: |
|
tamoxifen |
| Mutation: |
|
Insertion
|
| |
|
Mogem2(icre/ERT2)Lusu expression driven by
1 gene
Knock-in expression driven by:
| Organism |
Driver Gene |
Note |
| mouse |
Mog (MGI:97435) |
|
|
| |
|
Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (GGAAUCUGUCCACAGCAAAG) was used to introduce an internal ribosome entry site (IRES) followed by an icre/ERT2 fusion gene (codon improved Cre recombinase fused to a human estrogen receptor ligand binding domain) into the 3' UTR, immediately after the endogenous stop codon of the myelin oligodendrocyte glycoprotein (Mog) gene.
(J:101977, J:371751)
|
|
|
|
Activity: |
 Tissue activity of this recombinase allele
|
|
Driver:
|
Mog
(mouse)
|
| |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Mog Mutation: |
55 strains or lines available
|
|
| Original: |
J:371751 Zhang Y, et al., Neurons sequester the cholesterol-inhibiting TFEB in oligodendrocyte cytoplasm to safeguard myelination and neural function. Cell Rep. 2025 Sep 5;44(9):116252 |
| All: |
2 reference(s) |
|
Analysis Tools
