About   Help   FAQ
Mrc1em1(cre/ERT2)Jkpns
Endonuclease-mediated Allele Detail
Summary
Symbol: Mrc1em1(cre/ERT2)Jkpns
Name: mannose receptor, C type 1; endonuclease-mediated mutation 1, Jonathan Kipnis
MGI ID: MGI:7859686
Synonyms: Mrc1creERT2
Gene: Mrc1  Location: Chr2:14234225-14336834 bp, + strand  Genetic Position: Chr2, 10.46 cM
Alliance: Mrc1em1(cre/ERT2)Jkpns page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Inducible, Recombinase)
Inducer:    tamoxifen
Mutation:    Insertion
 
Mrc1em1(cre/ERT2)Jkpns expression driven by 1 gene
 
Mutation detailsUsing CRISPR/Cas9 endonuclease-mediated genome editing, a guide RNA (AGAAGCCTCATGGCCCAGAGTGG) was used to introduce a cre/ERT2 fusion gene (a Cre recombinase fused to a human estrogen receptor ligand binding domain) fused to a P2A self-cleaving peptide between the 5' UTR and exon 1 of the mannose receptor, C type 1 (Mrc1) gene on chromosome 2. (J:101977, J:361567)
Recombinase
activity
Activity:
 Tissue activity of this recombinase allele
Driver: Mrc1 (mouse)
Summary of all recombinase alleles driven by Mrc1.
 

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mrc1 Mutation:  88 strains or lines available
References
Original:  J:361567 Du S, et al., Brain-Engrafted Monocyte-derived Macrophages from Blood and Skull-Bone Marrow Exhibit Distinct Identities from Microglia. bioRxiv. 2024;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory