Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Symbol:	Mir216bem1Uf
Name:	microRNA 216b; endonuclease-mediated mutation 1, University of Florida
MGI ID:	MGI:6361477
Gene:	Mir216b  Location: Chr11:28696191-28696276 bp, + strand  Genetic Position: Chr11, 16.23 cM
Alliance:	Mir216bem1Uf page

Strain of Origin:

C57BL/6N

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mir216bem1Uf involves 1 genes/genome features (Mir217hg) View all   Mutation details: CRISPR-targeting of the seed sequence deleted 55 bp (CTGCAGGCAAATGTGATGTCACTGAAGAAACCACACACTTACCTGTAGAGATTCT). (J:278847)

View phenotypes and curated references for all genotypes (concatenated display).

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mir216b Mutation:	0 strains or lines available

Original:	J:278847 Sutaria DS, et al., Knockout of Acinar Enriched microRNAs in Mice Promote Duct Formation But Not Pancreatic Cancer. Sci Rep. 2019 Jul 31;9(1):11147
All:	1 reference(s)