Arglu1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Arglu1em1(IMPC)J |
Name: |
arginine and glutamate rich 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6208886 |
Gene: |
Arglu1 Location: Chr8:8715075-8740521 bp, - strand Genetic Position: Chr8, 3.57 cM
|
Alliance: |
Arglu1em1(IMPC)J page
|
IMPC: |
Arglu1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGTTTGAAACTTTTGCCA and AAGTTAGTTTTCTAATTCTT, which resulted in a 544 bp deletion beginning at Chromosome 8 position 8,683,487 bp and ending after 8,684,030 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000638285 (exon 2) and 318 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 113 and early truncation 14 amino acids later. In addition, there is a 5 bp insertion (ACCTG) at the deletion site.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|