Xlr3aem1(IMPC)Rbrc
Endonuclease-mediated Allele Detail
|
Symbol: |
Xlr3aem1(IMPC)Rbrc |
Name: |
X-linked lymphocyte-regulated 3A; endonuclease-mediated mutation 1, RIKEN BioResource Center |
MGI ID: |
MGI:6148328 |
Synonyms: |
Xlr3aem1Rbrc |
Gene: |
Xlr3a Location: ChrX:72129899-72140701 bp, - strand Genetic Position: ChrX, 37.29 cM
|
Alliance: |
Xlr3aem1(IMPC)Rbrc page
|
IMPC: |
Xlr3a gene page |
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from IMPC was generated at RIKEN BioResource Center by injecting CAS9 RNA and 2 guide sequences CCACGCCCGGCTACATCCTGAAT, CCTGTACCTTATTGGAGGCTAGA, which resulted in a Exon Deletion.
(J:237616)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Xlr3a Mutation: |
7 strains or lines available
|
|
Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
All: |
2 reference(s) |
|