Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Zfp827em1(IMPC)J
Name:	zinc finger protein 827; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:5829404
Synonyms:	Zfp827em1J
Gene:	Zfp827  Location: Chr8:79755066-79920395 bp, + strand  Genetic Position: Chr8, 37.36 cM
Alliance:	Zfp827em1(IMPC)J page
IMPC:	Zfp827 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele from project Zfp827-8389J-M1094 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTAGGGTCCAACAGTTCCA, TCAGTCCATGTCCATCTTTT, GCAAGCCTGACGACCGCACA and GGTCTGTGCTCTAAACTCTA, which resulted in a 289 bp deletion beginning at Chromosome 8 positive strand position 79,120,356 bp TTCCATGGATGTTATCTGGA, and ending after TCTAAACTCTATGGATTCAG at 79,120,644 bp (GRCm38/mm10). This mutation deletes exon 7 and 231 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 737 and early truncation 100 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

1 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp827 Mutation:	58 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)