Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Rmrpem1Litt
Name:	RNA component of mitochondrial RNAase P; endonuclease-mediated mutation 1, Dan R Littman
MGI ID:	MGI:5755455
Synonyms:	RmrpG270T
Gene:	Rmrp  Location: Chr4:43492785-43493059 bp, - strand  Genetic Position: Chr4, 23.04 cM
Alliance:	Rmrpem1Litt page

Strain of Origin:

C57BL/6NTac

Allele Type:    Endonuclease-mediated (Humanized sequence) Mutation:    Single point mutation   Mutation details: This allele was generated by injecting Cas9 RNA and guide RNA (sgRNA_Rmrp_Locus: CACGGGGCTCATTCTCAGCG), resulting in a single nucleotide change (270G>T) corresponding to an allele identified in cartilage-hair hypoplasia (CHH) patients (262G>T). Expression levels of mutant Rmrp RNA in T cells are similar to those found in wildtype animals. (J:228279)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rmrp Mutation:	2 strains or lines available

Original:	J:228279 Huang W, et al., DDX5 and its associated lncRNA Rmrp modulate TH17 cell effector functions. Nature. 2015 Dec 24;528(7583):517-22
All:	1 reference(s)