About   Help   FAQ
R1, L1 Primer Detail
Primers
  • Name
    R1, L1
  • Primer 1 Sequence
    GCAATTTATCCATGCCAAGTTTACC
  • Primer 2 Sequence
    CTACACTTAGGAGAGAAGCAGCCA
  • ID
    MGI:895095
Genes
Mtv29 mammary tumor virus locus 29
Polymorphisms
J:41179 Zhang DJ, et al., Immunogenetics. 1997;46(2):163-6
Notes: This primer pair amplifies both Mtv29 and Mtv14 in the SWR strain. The Mtv29 PCR product could be digested with BglII to produce 726bp and 197bp fragments while the Mtv14 PCR product could not be digested (0.92kb).
Endonuclease Gene Allele Fragments Strains
Not Specified Mtv29 a present C57L/J, MA/MyJ, SJL/J
b absent AKR/J, BALB/c, C3H/HeJ, C57BL/6J, CBA/J, DBA/2J, NZB/BlNJ, NZW/LacJ, SM/J, SWR
References
J:41179 Zhang DJ, et al., The Mtv29 gene encoding endogenous lymphoma superantigen in SJL mice, mapped to proximal chromosome 6. Immunogenetics. 1997;46(2):163-6

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory