About   Help   FAQ
55-2 Primer Detail
Primers
  • Name
    55-2
  • Primer 1 Sequence
    GATCTCTCCCAGCAGTATTTGG
  • Primer 2 Sequence
    GCTCAGGAAAAAAAATGGAGG
  • ID
    MGI:8561
  • Other IDs
    55-2 (BROAD)
Genes
D13Mit37b DNA segment, Chr 13, Massachusetts Institute of Technology 37b
D13Mit37a DNA segment, Chr 13, Massachusetts Institute of Technology 37a
Polymorphisms
J:37707 Scharf JM, et al., Genomics. 1996 Dec 15;38(3):405-17
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit37a a 240bp A/J
b 240bp C57BL/6J
s 240bp M. spretus
x 240bp 129
Not Specified D13Mit37b a not given A/J
b 240bp C57BL/6J
s not given M. spretus
x not given 129
References
J:37707 Scharf JM, et al., The mouse region syntenic for human spinal muscular atrophy lies within the Lgn1 critical interval and contains multiple copies of Naip exon 5. Genomics. 1996 Dec 15;38(3):405-17
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory