About   Help   FAQ
JMS13, JMS14 Primer Detail
Primers
  • Name
    JMS13, JMS14
  • Primer 1 Sequence
    AGCTCATGGATACCACAGGAGATG
  • Primer 2 Sequence
    ATATCCCTTGGACATAAAATGGC
  • ID
    MGI:8542
  • Region Covered
    encodes exon 5 sequences
  • Product Size
    0.309kb
Genes
Naip1-rs1 NLR family, apoptosis inhibitory protein 1, related sequence 1
Naip5 NLR family, apoptosis inhibitory protein 5
Naip4 NLR family, apoptosis inhibitory protein 4
Naip6 NLR family, apoptosis inhibitory protein 6
Naip1 NLR family, apoptosis inhibitory protein 1
Naip3 NLR family, apoptosis inhibitory protein 3
Naip2 NLR family, apoptosis inhibitory protein 2
Polymorphisms
J:37707 Scharf JM, et al., Genomics. 1996 Dec 15;38(3):405-17
Endonuclease Gene Allele Fragments Strains
Not Specified Naip1 a not given A/J
b not given C57BL/6J
s not given M. spretus
x not given 129
Not Specified Naip1-rs1 a not given A/J
b not given C57BL/6J
s not given M. spretus
x not given 129
Not Specified Naip2 a not given A/J
b not given C57BL/6J
s not given M. spretus
x not given 129
Not Specified Naip3 a not given A/J
b not given C57BL/6J
s not given M. spretus
x not given 129
Not Specified Naip4 a not given A/J
b not given C57BL/6J
s not given M. spretus
x not given 129
Not Specified Naip5 a not given A/J
b not given C57BL/6J
s not given M. spretus
x not given 129
Not Specified Naip6 a not given A/J
b not given C57BL/6J
s not given M. spretus
x not given 129
References
J:37707 Scharf JM, et al., The mouse region syntenic for human spinal muscular atrophy lies within the Lgn1 critical interval and contains multiple copies of Naip exon 5. Genomics. 1996 Dec 15;38(3):405-17

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory