Mtap 5'- F1, Mtap 5'- R1 Primer Detail MGI Mouse MGI:8537

About Help FAQ

Mtap 5'- F1, Mtap 5'- R1 Primer Detail

Name

Mtap 5'- F1, Mtap 5'- R1
Primer 1 Sequence

GGCGGGAGAGGAACACTTCT
Primer 2 Sequence

CTCGCCGACCACCACCAGCA
ID

MGI:8537
Region Covered

encodes a portion of exon 1
Product Size

0.179kb

Map1b

microtubule-associated protein 1B

J:37707 Scharf JM, et al., Genomics. 1996 Dec 15;38(3):405-17

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	Map1b	a	not given	A/J
		b	not given	C57BL/6J
		s	not given	M. spretus
		x	not given	129

J:37707 Scharf JM, et al., The mouse region syntenic for human spinal muscular atrophy lies within the Lgn1 critical interval and contains multiple copies of Naip exon 5. Genomics. 1996 Dec 15;38(3):405-17

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23