About   Help   FAQ
Slc12a2-pA, Slc12a2-pB Primer Detail
Primers
  • Name
    Slc12a2-pA, Slc12a2-pB
  • Primer 1 Sequence
    CCCACCGACCAGTTAGTG
  • Primer 2 Sequence
    GGGTAGATCATCAGTCATCTC
  • ID
    MGI:832
Genes
Slc12a2 solute carrier family 12, member 2
Polymorphisms
J:21042 Delpire E, et al., J Biol Chem. 1994 Oct 14;269(41):25677-83
Notes: Single strand conformation polymorphism analysis was used to determine strain differences for mapping. Authors use C3H, C57, SP and CA for inbred strain designations.
Endonuclease Gene Allele Fragments Strains
Slc12a2 a not given AKR, C57BL/6J
b not given CA, SP
d not given 129P3/J, A/J, C3H, DBA/2J
References
J:21042 Delpire E, et al., Molecular cloning and chromosome localization of a putative basolateral Na(+)-K(+)-2Cl- cotransporter from mouse inner medullary collecting duct (mIMCD-3) cells. J Biol Chem. 1994 Oct 14;269(41):25677-83

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory