About   Help   FAQ
JS140, JS135 Primer Detail
Primers
  • Name
    JS140, JS135
  • Primer 1 Sequence
    TTTGCCGCAGAAGATTCTGG
  • Primer 2 Sequence
    GACTGCTCTTCCGAAGGTCC
  • ID
    MGI:806
Genes
Iap5rb1 intracisternal A-type particle, U5 region, SINE repeat b-1
Iap5rb10 intracisternal A-type particle, U5 region, SINE repeat b-10
Iap5rb11 intracisternal A-type particle, U5 region, SINE repeat b-11
Iap5rb12 intracisternal A-type particle, U5 region, SINE repeat b-12
Iap5rb13 intracisternal A-type particle, U5 region, SINE repeat b-13
Iap5rb14 intracisternal A-type particle, U5 region, SINE repeat b-14
Iap5rb15 intracisternal A-type particle, U5 region, SINE repeat b-15
Iap5rb16 intracisternal A-type particle, U5 region, SINE repeat b-16
Iap5rb17 intracisternal A-type particle, U5 region, SINE repeat b-17
Iap5rb18 intracisternal A-type particle, U5 region, SINE repeat b-18
Iap5rb19 intracisternal A-type particle, U5 region, SINE repeat b-19
Iap5rb2 intracisternal A-type particle, U5 region, SINE repeat b-2
Iap5rb20 intracisternal A-type particle, U5 region, SINE repeat b-20
Iap5rb21 intracisternal A-type particle, U5 region, SINE repeat b-21
Iap5rb23 intracisternal A-type particle, U5 region, SINE repeat b-23
Iap5rb24 intracisternal A-type particle, U5 region, SINE repeat b-24
Iap5rb3 intracisternal A-type particle, U5 region, SINE repeat b-3
Iap5rb4 intracisternal A-type particle, U5 region, SINE repeat b-4
Iap5rb5 intracisternal A-type particle, U5 region, SINE repeat b-5
Iap5rb6 intracisternal A-type particle, U5 region, SINE repeat b-6
Iap5rb7 intracisternal A-type particle, U5 region, SINE repeat b-7
Iap5rb8 intracisternal A-type particle, U5 region, SINE repeat b-8
Iap5rb9 intracisternal A-type particle, U5 region, SINE repeat b-9
Polymorphisms
J:21511 Kaushik N, et al., Mamm Genome. 1994 Nov;5(11):688-95
Endonuclease Gene Allele Fragments Strains
Iap5rb1 b 129bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5rb2 b 141bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5rb3 b 170bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5rb4 b 185bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5rb5 b 198bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap5rb6 b 205bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap5rb7 b 213bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap5rb8 b 328bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5rb9 b 375bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5rb10 b 520bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5rb11 b 820bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap5rb12 b 850bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap5rb13 b 121bp STS/A
s absent BALB/cJ, M. spretus
Iap5rb14 b 136bp BALB/cJ
s absent M. spretus, STS/A
Iap5rb15 b 143bp BALB/cJ
s absent M. spretus, STS/A
Iap5rb16 b 145bp STS/A
s absent BALB/cJ, M. spretus
Iap5rb17 b 170bp BALB/cJ
s absent M. spretus, STS/A
Iap5rb18 b 213bp BALB/cJ
s absent M. spretus, STS/A
Iap5rb19 b 217bp STS/A
s absent BALB/cJ, M. spretus
Iap5rb20 b 268bp BALB/cJ
s absent M. spretus, STS/A
Iap5rb21 b 361bp STS/A
s absent BALB/cJ, M. spretus
Iap5rb22 b 420bp BALB/cJ
s absent M. spretus, STS/A
Iap5rb23 b 550bp BALB/cJ
s absent M. spretus, STS/A
Iap5rb24 b 565bp STS/A
s absent BALB/cJ, M. spretus
References
J:21511 Kaushik N, et al., Intracisternal A-type particle elements as genetic markers: detection by repeat element viral element amplified locus-PCR. Mamm Genome. 1994 Nov;5(11):688-95
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory