About   Help   FAQ
JS139, JS134 Primer Detail
Primers
  • Name
    JS139, JS134
  • Primer 1 Sequence
    GTTTACCACTTAGAACACAG
  • Primer 2 Sequence
    CTTCTGGAGTGTCTGAAGAC
  • ID
    MGI:802
Genes
Iap3ra1 intracisternal A-type particle, U3 region, SINE repeat a-1
Iap3ra10 intracisternal A-type particle, U3 region, SINE repeat a-10
Iap3ra11 intracisternal A-type particle, U3 region, SINE repeat a-11
Iap3ra12 intracisternal A-type particle, U3 region, SINE repeat a-12
Iap3ra13 intracisternal A-type particle, U3 region, SINE repeat a-13
Iap3ra14 intracisternal A-type particle, U3 region, SINE repeat a-14
Iap3ra15 intracisternal A-type particle, U3 region, SINE repeat a-15
Iap3ra16 intracisternal A-type particle, U3 region, SINE repeat a-16
Iap3ra17 intracisternal A-type particle, U3 region, SINE repeat a-17
Iap3ra18 intracisternal A-type particle, U3 region, SINE repeat a-18
Iap3ra2 intracisternal A-type particle, U3 region, SINE repeat a-2
Iap3ra3 intracisternal A-type particle, U3 region, SINE repeat a-3
Iap3ra4 intracisternal A-type particle, U3 region, SINE repeat a-4
Iap3ra5 intracisternal A-type particle, U3 region, SINE repeat a-5
Iap3ra6 intracisternal A-type particle, U3 region, SINE repeat a-6
Iap3ra7 intracisternal A-type particle, U3 region, SINE repeat a-7
Iap3ra8 intracisternal A-type particle, U3 region, SINE repeat a-8
Iap3ra9 intracisternal A-type particle, U3 region, SINE repeat a-9
Polymorphisms
J:21511 Kaushik N, et al., Mamm Genome. 1994 Nov;5(11):688-95
Endonuclease Gene Allele Fragments Strains
Iap3ra1 b 127bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3ra2 b 133bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap3ra3 b 145bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3ra4 b 239bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap3ra5 b 285bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap3ra6 b 291bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3ra7 b 400bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap3ra8 b 412bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3ra9 b 600bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3ra10 b 1000bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap3ra11 b 182bp STS/A
s absent BALB/cJ, M. spretus
Iap3ra12 b 226bp STS/A
s absent BALB/cJ, M. spretus
Iap3ra13 b 231bp BALB/cJ
s absent M. spretus, STS/A
Iap3ra14 b 239bp STS/A
s absent BALB/cJ, M. spretus
Iap3ra15 b 293bp STS/A
s absent BALB/cJ, M. spretus
Iap3ra16 b 400bp BALB/cJ
s absent M. spretus, STS/A
Iap3ra17 b 413bp STS/A
s absent BALB/cJ, M. spretus
Iap3ra18 b 600bp BALB/cJ
s absent M. spretus, STS/A
References
J:21511 Kaushik N, et al., Intracisternal A-type particle elements as genetic markers: detection by repeat element viral element amplified locus-PCR. Mamm Genome. 1994 Nov;5(11):688-95
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory