About   Help   FAQ
Tnfa-pC, Tnfa-pD Primer Detail
Primers
  • Name
    Tnfa-pC, Tnfa-pD
  • Primer 1 Sequence
    CCCATCGATTGAGGTGAGTGTCTGGGCAACCCTT
  • Primer 2 Sequence
    CCCAAGCTTACTTCTGTGTAGGAAAAGGTTA
  • ID
    MGI:801
  • Product Size
    ~0.5kb
Genes
Tnf tumor necrosis factor
Polymorphisms
J:13317 Beutler B, et al., Gene. 1993 Jul 30;129(2):279-83
Notes: Strains were PCR amplified, inserted into vectors and sequenced. Nucleotide sequence was the basis for assigning alleles.
Endonuclease Gene Allele Fragments Strains
Tnf a not given M. shanghai
b not given BALB/c
c not given C3H/HeN
d not given NZW
e not given SWR
f not given M. m. castaneus
s not given C57BL/6, M. spretus, NOD
References
J:13317 Beutler B, et al., Polymorphism of the mouse TNF-alpha locus: sequence studies of the 3'-untranslated region and first intron [published erratum appears in Gene 1993 Dec 22;136(1-2):379]. Gene. 1993 Jul 30;129(2):279-83

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory