About   Help   FAQ
D17Dgm6-pA, D17Dgm6-pB Primer Detail
Primers
  • Name
    D17Dgm6-pA, D17Dgm6-pB
  • Primer 1 Sequence
    TGACTGATCCCCAGAAGTCC
  • Primer 2 Sequence
    GGGAGGACGCTTCCCTCC
  • ID
    MGI:7778
  • Region Covered
    3' untranslated region of Lmp2
Genes
D17Dgm6 DNA segment, Chr 17, Department of Geriatric Medicine 6
Psmb9 proteasome (prosome, macropain) subunit, beta type 9 (large multifunctional peptidase 2)
Polymorphisms
J:29073 Ikegami H, et al., J Clin Invest. 1995 Oct;96(4):1936-42
Endonuclease Gene Allele Fragments Strains
MspI D17Dgm6 b 0.069,0.058kb C57BL/6, CTS/Shi, NOD/Shi, NON/Shi
c 0.127kb BALB/c, C3H/He
References
J:29073 Ikegami H, et al., Identification of a new susceptibility locus for insulin-dependent diabetes mellitus by ancestral haplotype congenic mapping. J Clin Invest. 1995 Oct;96(4):1936-42
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory