About   Help   FAQ
D17Dgm3-pA, D17Dgm3-pB Primer Detail
Primers
  • Name
    D17Dgm3-pA, D17Dgm3-pB
  • Primer 1 Sequence
    GGTCCTTTTTGTGGAGCTGG
  • Primer 2 Sequence
    GATGGCCCTTACTCCTCGG
  • ID
    MGI:7775
  • Region Covered
    includes portion of coding region for H2-Oa
Genes
H2-Oa histocompatibility 2, O region alpha locus
D17Dgm3 DNA segment, Chr 17, Department of Geriatric Medicine 3
Polymorphisms
J:29073 Ikegami H, et al., J Clin Invest. 1995 Oct;96(4):1936-42
Endonuclease Gene Allele Fragments Strains
MspI D17Dgm3 b 0.052,0.023kb BALB/c, C57BL/6, CTS/Shi, NOD/Shi
h 0.069kb C3H/He
n 0.075kb NON/Shi
References
J:29073 Ikegami H, et al., Identification of a new susceptibility locus for insulin-dependent diabetes mellitus by ancestral haplotype congenic mapping. J Clin Invest. 1995 Oct;96(4):1936-42
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory