D17Dgm3-pA, D17Dgm3-pB Primer Detail MGI Mouse MGI:7775

About Help FAQ

D17Dgm3-pA, D17Dgm3-pB Primer Detail

Name

D17Dgm3-pA, D17Dgm3-pB
Primer 1 Sequence

GGTCCTTTTTGTGGAGCTGG
Primer 2 Sequence

GATGGCCCTTACTCCTCGG
ID

MGI:7775
Region Covered

includes portion of coding region for H2-Oa

H2-Oa	histocompatibility 2, O region alpha locus
D17Dgm3	DNA segment, Chr 17, Department of Geriatric Medicine 3

J:29073 Ikegami H, et al., J Clin Invest. 1995 Oct;96(4):1936-42

Endonuclease	Gene	Allele	Fragments	Strains
MspI	D17Dgm3	b	0.052,0.023kb	BALB/c, C57BL/6, CTS/Shi, NOD/Shi
		h	0.069kb	C3H/He
		n	0.075kb	NON/Shi

J:29073 Ikegami H, et al., Identification of a new susceptibility locus for insulin-dependent diabetes mellitus by ancestral haplotype congenic mapping. J Clin Invest. 1995 Oct;96(4):1936-42

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13