About   Help   FAQ
R90b Primer Detail
Primers
  • Name
    R90b
  • Primer 1 Sequence
    AGGTGTCATTTTTTCCCTTGG
  • Primer 2 Sequence
    ACAAATAATTGAACCACTATG
  • ID
    MGI:77
  • Product Size
    90bp
Genes
D4Nds9 DNA segment, Chr 4, Nuffield Department of Surgery 9
Polymorphisms
J:3227 Cornall RJ, et al., Mamm Genome. 1992;3(11):620-4
Notes: Genomic DNA from the indicated strains was amplified via PCR, run on an 8% agarose gel and stained with ethidium bromide.
Endonuclease Gene Allele Fragments Strains
D4Nds9 a largest M. spretus
b 2nd largest AKR/J, B6.PL-Thy1a/SnJ, C57BL/6J, C57BL/10-H2g7, DBA/2J, NOD, NON
J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9
Endonuclease Gene Allele Fragments Strains
D4Nds9 c 0.15kb CAST/EiJ
p 0.09kb STOCK Whrnwi
w 0.09kb STOCK Whrnwi
References
J:3227 Cornall RJ, et al., Mouse microsatellites from a flow-sorted 4:6 Robertsonian chromosome. Mamm Genome. 1992;3(11):620-4
J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory