About   Help   FAQ
Tll-pA, Tll-pB Primer Detail
Primers
  • Name
    Tll-pA, Tll-pB
  • Primer 1 Sequence
    GGTGATGTGGAATAGTGGTC
  • Primer 2 Sequence
    GTGTCAACAGGTTAAGCTGG
  • ID
    MGI:7679
  • Region Covered
    3' untranslated region
  • Synonyms
    Tll-pA1, Tll-pB1
Genes
Tll1 tolloid-like
Polymorphisms
J:33379 Takahara K, et al., Genomics. 1996 1;34(2):157-65
Endonuclease Gene Allele Fragments Strains
Tll1 a 237bp 129/Sv
b 242bp C57BL/6J
s 218bp M. spretus
J:48971 Grewal PK, et al., Mamm Genome. 1998 Aug;9(8):603-7
Notes: These primers were used for SSCP mapping.
Endonuclease Gene Allele Fragments Strains
Not Specified Tll1 b 242bp C57BL/6J
s 218bp SPR
References
J:33379 Takahara K, et al., Characterization of a novel gene product (mammalian tolloid-like) with high sequence similarity to mammalian tolloid/bone morphogenetic protein-1. Genomics. 1996 1;34(2):157-65
J:48971 Grewal PK, et al., High-resolution mapping of mouse chromosome 8 identifies an evolutionary chromosomal breakpoint. Mamm Genome. 1998 Aug;9(8):603-7

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory