Tll-pA, Tll-pB Primer Detail MGI Mouse MGI:7679

Tll-pA, Tll-pB Primer Detail

Name

Tll-pA, Tll-pB
Primer 1 Sequence

GGTGATGTGGAATAGTGGTC
Primer 2 Sequence

GTGTCAACAGGTTAAGCTGG
ID

MGI:7679
Region Covered

3' untranslated region
Synonyms

Tll-pA1, Tll-pB1

Tll1

tolloid-like

J:33379 Takahara K, et al., Genomics. 1996 1;34(2):157-65

Gene	Allele	Fragments	Strains
Tll1	a	237bp	129/Sv
	b	242bp	C57BL/6J
	s	218bp	M. spretus

J:48971 Grewal PK, et al., Mamm Genome. 1998 Aug;9(8):603-7

Notes: These primers were used for SSCP mapping.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	Tll1	b	242bp	C57BL/6J
Not Specified	Tll1	s	218bp	SPR

J:33379 Takahara K, et al., Characterization of a novel gene product (mammalian tolloid-like) with high sequence similarity to mammalian tolloid/bone morphogenetic protein-1. Genomics. 1996 1;34(2):157-65

J:48971 Grewal PK, et al., High-resolution mapping of mouse chromosome 8 identifies an evolutionary chromosomal breakpoint. Mamm Genome. 1998 Aug;9(8):603-7

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23