About   Help   FAQ
Sox2-pF, Sox2-pR Primer Detail
Primers
  • Name
    Sox2-pF, Sox2-pR
  • Primer 1 Sequence
    GCGGAGTGGAAACTTTTGTCC
  • Primer 2 Sequence
    CGGGAAGCGTGTACTTATCCTT
  • ID
    MGI:7493830
Genes
Sox2 SRY (sex determining region Y)-box 2
Expression
  • Assay Results
    22
References
J:204971 Li L, et al., Location of transient ectodermal progenitor potential in mouse development. Development. 2013 Nov;140(22):4533-43
J:310878 Li PY, et al., CRISPR/Cas9-mediated gene editing on Sox2ot promoter leads to its truncated expression and does not influence neural tube closure and embryonic development in mice. Biochem Biophys Res Commun. 2021 Oct 8;573:107-111
J:344836 Abou-Jaoude A, et al., Idax and Rinf facilitate expression of Tet enzymes to promote neural and suppress trophectodermal programs during differentiation of embryonic stem cells. Stem Cell Res. 2022 May;61:102770
J:360305 Zhu Z, et al., Isl Identifies the Extraembryonic Mesodermal/Allantois Progenitors and is Required for Placenta Morphogenesis and Vasculature Formation. Adv Sci (Weinh). 2024 Aug;11(32):e2400238

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory