About   Help   FAQ
Amh-pF, Amh-pR Primer Detail
Primers
  • Name
    Amh-pF, Amh-pR
  • Primer 1 Sequence
    CGAGCTCTTGCTGAAGTTCCA
  • Primer 2 Sequence
    GAAGTCCACGGTTAGCACCAA
  • ID
    MGI:7465170
  • Synonyms
    AQ- Amh-F, AQ- Amh-R
Genes
Amh anti-Mullerian hormone
Expression
  • Assay Results
    24
References
J:164280 Bowles J, et al., FGF9 suppresses meiosis and promotes male germ cell fate in mice. Dev Cell. 2010 Sep 14;19(3):440-9
J:220472 Zhao L, et al., Female-to-male sex reversal in mice caused by transgenic overexpression of Dmrt1. Development. 2015 Mar 15;142(6):1083-8
J:238708 Gonen N, et al., Normal Levels of Sox9 Expression in the Developing Mouse Testis Depend on the TES/TESCO Enhancer, but This Does Not Act Alone. PLoS Genet. 2017 Jan;13(1):e1006520
J:240405 Zhao L, et al., SOX4 regulates gonad morphogenesis and promotes male germ cell differentiation in mice. Dev Biol. 2017 Mar 01;423(1):46-56
J:370213 Windley SP, et al., NEDD4 Promotes Sertoli Cell Proliferation and Adult Leydig Cell Differentiation in the Murine Testis. Endocrinology. 2025 Jul 8;166(9)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory